Journal:

Article Title: Hepatocyte nuclear factor 4? orchestrates expression of cell adhesion proteins during the epithelial transformation of the developing liver

doi: 10.1073/pnas.0600246103

Figure Lengend Snippet: Hepatocyte-specific loss of E-cadherin does not affect the formation of cell junctions in the liver. (A) RT-PCR showed loss of E-cadherin (E-cad) mRNA in livers of Cdh1loxP/loxP;AlfpCre mice compared with control Cdh1loxP/+;AlfpCre and WT littermates. Hnf4a levels were unchanged, and hypoxanthine guanine phosphoribosyl transferase 1 (Hprt1) confirmed equal loading. (B) Immunoblot analysis of liver extracts indicated that E-cadherin (E-cad) protein is undetectable in the Cdh1loxP/loxP;AlfpCre livers compared with controls (Cdh1loxP/+;AlfpCre and WT). Total protein levels of the tight junction protein OCLN were unchanged, and β-actin (ACTB) demonstrated equal loading. (C) Immunohistochemistry detected E-cadherin between hepatocytes in control livers (Top Left) but not between hepatocytes in Cdh1loxP/loxP;AlfpCre livers (Top Right) (Inset is higher magnification). Confocal immunofluorescence microscopy was used to detect TJP1 (also known as ZO1) at the apical surface of the hepatocytes in both control (Cdh1loxP/+;AlfpCre, Middle Left) and Cdh1loxP/loxP;AlfpCre (Middle Right) livers. Junctional complexes (indicated by brackets) were identified in both control (Cdh1loxP/+;AlfpCre, Bottom Left) and Cdh1loxP/loxP;AlfpCre (Bottom Right) livers by transmission electron microscopy. Asterisks indicate bile canaliculi, which confirm that hepatocytes are polarized in the absence of E-cadherin. High-resolution electron microscopy images are provided in Fig. 5, which is published as supporting information on the PNAS web site.

Article Snippet: Antibodies against the following proteins were used: claudin-1 (rabbit polyclonal; Zymed; 1:100), connexin 32 (rabbit polyclonal; Zymed; 1:200), ZO1 (rabbit polyclonal; Zymed; 1:200), and Alexa-Fluor 488 goat anti-rabbit (Invitrogen; 1:500).

Techniques: Reverse Transcription Polymerase Chain Reaction, Western Blot, Immunohistochemistry, Immunofluorescence, Microscopy, Transmission Assay, Electron Microscopy

Journal: BMC Gastroenterology

Article Title: Role of tight junction proteins in gastroesophageal reflux disease

doi: 10.1186/1471-230X-12-128

Figure Lengend Snippet: Characteristics of primers, RT-PCR protocol and antibodies

Article Snippet: ZO-1 , fw: TCTGATCATTCCAGGCACTCGC rv: CCACATCTGGTTGCCAACTTGG 225 bp, 58°C , polyclonal rabbit anti-ZO-1 antibody No. 61–7300, (Invitrogen, Carlsbad, CA, USA, Protease retrieval, Final dilution: 1:30.

Techniques: Sequencing

Journal: BMC Gastroenterology

Article Title: Role of tight junction proteins in gastroesophageal reflux disease

doi: 10.1186/1471-230X-12-128

Figure Lengend Snippet: Expression of tight junction-related components in esophageal mucosa in patients with GERD

Article Snippet: ZO-1 , fw: TCTGATCATTCCAGGCACTCGC rv: CCACATCTGGTTGCCAACTTGG 225 bp, 58°C , polyclonal rabbit anti-ZO-1 antibody No. 61–7300, (Invitrogen, Carlsbad, CA, USA, Protease retrieval, Final dilution: 1:30.

Techniques: Expressing

Journal: BMC Gastroenterology

Article Title: Role of tight junction proteins in gastroesophageal reflux disease

doi: 10.1186/1471-230X-12-128

Figure Lengend Snippet: Immunohistochemical stainings of tight junction-related proteins in esophageal mucosa. Occludin, Claudin-1, -2 and ZO-1,-2 are displayed by brown or red staining, respectively. Panels illustrate representative staining for controls and samples obtained from patients with NERD. Immunohistochemical staining was observed in the esophageal squamous epithelium mainly at the basal and suprabasal zone. Claudin-1/2 and ZO-1 showed partly a membranous staining. (Zeiss Axioskop 50; camera: Nikon coolpix 990).

Article Snippet: ZO-1 , fw: TCTGATCATTCCAGGCACTCGC rv: CCACATCTGGTTGCCAACTTGG 225 bp, 58°C , polyclonal rabbit anti-ZO-1 antibody No. 61–7300, (Invitrogen, Carlsbad, CA, USA, Protease retrieval, Final dilution: 1:30.

Techniques: Immunohistochemical staining, Staining

Journal: The Journal of Cell Biology

Article Title: The keratin-binding protein Albatross regulates polarization of epithelial cells

doi: 10.1083/jcb.200803133

Figure Lengend Snippet: Impaired AJC formation in Albatross knockdown cells. (A) Double staining for Albatross (red) and the undercoat proteins (green) for each AJC component: TJ, ZO-1; AJ, afadin; DS, desmoplakin. Top and bottom columns show projections of x-y planes and z sections, respectively. Albatross knockdown A549 (Albatross KD) cells lack accumulation of these proteins at the cell–cell borders except in regions where residual Albatross is present. (B) Cell–cell adhesive properties evaluated by a cell aggregation assay. In the differential interference contrast images, control cells show cell aggregation. With Albatross knockdown A549 (A1050 and A1160) cells, the aggregated cell population is reduced and free cells are increased. The percentages of single cells in total cells (mean ± SD) are: control, 36.1 ± 3.9; A1050, 52.4 ± 2.8; A1160 cells, 59.4 ± 10.2. n = 4 and P < 0.01. (C) Immunoelectron microscopy of A549 cells with anti-Albatross antibodies. Note that the cytoplasm in the vicinity of AJCs is labeled. TJ, AJ, and DS are indicated. Arrows indicate cell–cell contacts. (D) Quantitative data from C. (E) BC fraction and AJ fraction were immunostained for Albatross with the indicated AJC proteins, PKCζ or Par3. Note that Albatross is well colocalized with them. (F) Immunoblotting of fractions derived from mouse liver: homogenates (left), BC (middle), and AJ (right). Not only Albatross but also Par3 is enriched in line with the concentrations of the indicated AJC components. (G) Immunoprecipitation of A549 cells with anti-Albatross antibodies. Start and IP indicate starting lysates and immunoprecipitates with preimmune (Pre.) and anti-Albatross (αAlb.) antibodies, respectively. Note the Par3 precipitation with Albatross. Among AJC components, ZO-1 also coprecipitated. (H) Immunoprecipitation analysis with tagged Albatross and Par3. Start and IP indicate starting lysates and immunoprecipitates with anti-GFP antibodies, respectively. Left lanes show results for negative controls expressing GFP alone. Par3 was the most precipitated with GFP-Albatross among coexpressed myc-Par3, -Par6, and -PKCλ. Bars: (A) 10 μm; (B) 100 μm; (C) 0.1 μm; (E, BC) 13 μm; (E, AJ) 10 μm.

Article Snippet: The following primary antibodies were used: monoclonal mouse anti-keratin 8 (Ks 8.7; Progen Pharmaceuticals), monoclonal mouse anti-keratin 18 (CY-90; Sigma-Aldrich), polyclonal mouse anti-pan keratin (Sigma-Aldrich), polyclonal guinea pig anti-K8/18 (Progen Pharmaceuticals), polyclonal guinea pig anti–desmoplakin 1 (Progen Pharmaceuticals), monoclonal mouse anti–desmoplakin 1 and 2 (Progen Pharmaceuticals), monoclonal mouse anti–ZO-1 (1; BD Biosciences), monoclonal rat anti–ZO-1 (BM173; Acris Antibodies, GmbH), monoclonal rat anti–E-cadherin (ECCD-2; EMD), monoclonal mouse anti-neurofilaments, monoclonal rat anti–platelet/endothelial cell adhesion molecule (anti-PECAM; CD31; BD Biosciences), monoclonal mouse anti–α-tubulin (B-5-1-2; Sigma-Aldrich), monoclonal mouse anti–claudin-2 (12H12; Invitrogen), monoclonal mouse anti–desmocollin-2/3 (7G6; Invitrogen), monoclonal mouse anti–desmoglein 2 (10G11; Progen Pharmaceuticals), monoclonal mouse anti–nectin-1 (CK8; Invitrogen), monoclonal mouse anti–β-catenin (14; BD Biosciences), polyclonal rabbit anti-ezrin (Millipore), rabbit anti-Par3 polyclonal antibody (provided by S. Ohno, Yokohama City University, Yokohama, Kanagawa, Japan; Millipore), monoclonal mouse anti-occludin (OC-3F10; Invitrogen), monoclonal rat anti–nectin-2 (502–57; HyCult Biotechnology), polyclonal rabbit anti-GFP (Santa Cruz Biotechnology, Inc.), polyclonal rabbit anti-PKCζ (Santa Cruz Biotechnology, Inc.), and polyclonal rabbit anti–glyceraldehyde 3-phosphate dehydrogenase (anti-GAPDH) conjugated to HRP (Abcam).

Techniques: Double Staining, Immuno-Electron Microscopy, Labeling, Western Blot, Derivative Assay, Immunoprecipitation, Expressing

Journal: The Journal of Cell Biology

Article Title: The keratin-binding protein Albatross regulates polarization of epithelial cells

doi: 10.1083/jcb.200803133

Figure Lengend Snippet: Functions of keratins and Albatross–Par3 complexes. (A–C) The amounts of Albatross protein and mRNA were analyzed in both keratin 8 and keratin 18 (K8/18)-introduced SW13 cells. As a control, an empty vector was transfected. As loading controls, α-tubulin and GAPDH were used. Two independent experiments were performed. (A) Immunoblotting. In transiently K8/18-introduced SW13 cells, the amount of Albatross protein is elevated, along with the amount of keratin 18. (B) With stable lines, the same results were obtained. (C) RT-PCR. In K8/18-introduced SW13 cells, the mRNA level of K18 is elevated, but not that of Albatross. β-actin is included as an internal control. (D) Double staining for K8/18 and the indicated proteins: Albatross, AJC components of ZO-1 and afadin, and Par3. (top) In control cells, K8/18 is absent and only limited amounts of Albatross are apparent at cell–cell junctions. In stably K8/18-introduced SW13 cells, Albatross is well localized in cell–cell junctions compared with control cells. (middle and bottom) ZO-1, afadin, and Par3 similarly accumulated at the cell–cell borders in stably K8/18-introduced SW13 cells. (E) Immunostaining of stably K8/18-introduced SW13 cells transfected with control or Albatross siRNA. Note that ZO-1, afadin, and Par3 are reduced at cell–cell borders with knockdown of Albatross. (F) A model for the regulation of AJC and lateral domains with the Albatross–Par3 complex and keratins. Albatross–Par3 complexes regulate the formation of AJC and maintain lateral membrane identity. However, Par3 without Albatross regulates apical structures. Keratins stabilize Albatross, promoting the formation of AJC. Knockdown effects are also indicated. Bars, 10 μm.

Article Snippet: The following primary antibodies were used: monoclonal mouse anti-keratin 8 (Ks 8.7; Progen Pharmaceuticals), monoclonal mouse anti-keratin 18 (CY-90; Sigma-Aldrich), polyclonal mouse anti-pan keratin (Sigma-Aldrich), polyclonal guinea pig anti-K8/18 (Progen Pharmaceuticals), polyclonal guinea pig anti–desmoplakin 1 (Progen Pharmaceuticals), monoclonal mouse anti–desmoplakin 1 and 2 (Progen Pharmaceuticals), monoclonal mouse anti–ZO-1 (1; BD Biosciences), monoclonal rat anti–ZO-1 (BM173; Acris Antibodies, GmbH), monoclonal rat anti–E-cadherin (ECCD-2; EMD), monoclonal mouse anti-neurofilaments, monoclonal rat anti–platelet/endothelial cell adhesion molecule (anti-PECAM; CD31; BD Biosciences), monoclonal mouse anti–α-tubulin (B-5-1-2; Sigma-Aldrich), monoclonal mouse anti–claudin-2 (12H12; Invitrogen), monoclonal mouse anti–desmocollin-2/3 (7G6; Invitrogen), monoclonal mouse anti–desmoglein 2 (10G11; Progen Pharmaceuticals), monoclonal mouse anti–nectin-1 (CK8; Invitrogen), monoclonal mouse anti–β-catenin (14; BD Biosciences), polyclonal rabbit anti-ezrin (Millipore), rabbit anti-Par3 polyclonal antibody (provided by S. Ohno, Yokohama City University, Yokohama, Kanagawa, Japan; Millipore), monoclonal mouse anti-occludin (OC-3F10; Invitrogen), monoclonal rat anti–nectin-2 (502–57; HyCult Biotechnology), polyclonal rabbit anti-GFP (Santa Cruz Biotechnology, Inc.), polyclonal rabbit anti-PKCζ (Santa Cruz Biotechnology, Inc.), and polyclonal rabbit anti–glyceraldehyde 3-phosphate dehydrogenase (anti-GAPDH) conjugated to HRP (Abcam).

Techniques: Plasmid Preparation, Transfection, Western Blot, Reverse Transcription Polymerase Chain Reaction, Double Staining, Stable Transfection, Immunostaining